Home | | Zoology 12th Std | Molecular Genetics: Evaluation

Molecular Genetics: Evaluation - Important Questions and choose the correct answer - Zoology | Study Material, Lecturing Notes, Assignment, Reference, Wiki description explanation, brief detail |

Chapter: 12th Zoology : Molecular Genetics

Molecular Genetics: Evaluation

Zoology : Molecular Genetics - Important Questions and choose the correct answer - Zoology

Evaluation

 

1. Hershey and Chase experiment with bacteriophage showed that

a) Protein gets into the bacterial cells

b) DNA is the genetic material

c) DNA contains radioactive sulphur

d) Viruses undergo transformation

 

2. DNA and RNA are similar with respect to

a) Thymine as a nitrogen base

b) A single-stranded helix shape

c) Nucleotide containing sugars, nitrogen bases and phosphates

d) The same sequence of nucleotides for the amino acid phenyl alanine

 

3. A mRNA molecule is produced by

a) Replication

b) Transcription

c) Duplication

d) Translation

 

4. The total number of nitrogenous bases in human genome is estimated to be about

a) 3.5 million

b) 35000

c) 35 million

d) 3.1 billion

 

5. E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?

(a) One high and one low density band.

(b) One intermediate density band.

(c) One high and one intermediate density band.

(d) One low and one intermediate density band.

 

6. What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

(a) Origin of replication occurs only at the 5' end of the molecules.

(b) DNA ligase works only in the 3' → 5' direction.

(c) DNA polymerase can join new nucleotides only to the 3' end of the growing stand.

(d) Helicases and single-strand binding proteins that work at the 5' end.

 

7. Which of the following is the correct sequence of event with reference to the central dogma?

(a) Transcription, Translation, Replication

(b) Transcription, Replication, Translation

(c) Duplication, Translation, Transcription

(d) Replication, Transcription, Translation

 

8. Which of the following statements about DNA replication is not correct?

(a) Unwinding of DNA molecule occurs as hydrogen bonds break.

(b) Replication occurs as each base is paired with another exactly like it.

(c) Process is known as semi conservative replication because one old strand is conserved in the new molecule.

(d) Complementary base pairs are held together with hydrogen bonds.

 

9. Which of the following statements is not true about DNA replication in eukaryotes?

(a) Replication begins at a single origin of replication.

(b) Replication is bidirectional from the origins.

(c) Replication occurs at about 1 million base pairs per minute.

(d) There are numerous different bacterial chromosomes, with replication ocurring in each at the same time.

 

10. The first codon to be deciphered was __________ which codes for ________.

(a) AAA, proline

(b) GGG, alanine

(c) UUU, Phenylalanine

(d)TTT, arginine

 

11. Meselson and Stahl’s experiment proved

(a)Transduction

(b) Transformation

(c) DNA is the genetic material

(d) Semi-conservative nature of DNA replication

 

12. Ribosomes are composed of two subunits; the smaller subunit of a ribosome has a binding site for _________ and the larger subunit has two binding sites for two __________. Ans (mRNA, tRNA)

 

13. An operon is a:

(a) Protein that suppresses gene expression

(b) Protein that accelerates gene expression

(c) Cluster of structural genes with related function

(d) Gene that switched other genes on or off

 

14. When lactose is present in the culture medium:

(a) Transcription of lac y, lac z, lac a genes occurs.

(b) Repressor is unable to bind to the operator.

(c) Repressor is able to bind to the operator.

(d) Both (a) and (b) are correct.

 

15. Give reasons: Genetic code is ‘universal’.

 

16. Name the parts marked ‘A’ and ‘B’ in the given transcription unit:


 

17. Differentiate - Leading stand and lagging strand

 

18. Differentiate - Template strand and coding strand.

 

19. Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

 

20. State any three goals of the human genome project.

 

21. In E.coli, three enzymes β- galactosidase, permease and transacetylase are produced in the presence of lactose. Explain why the enzymes are not synthesized in the absence of lactose.

 

22. Distinguish between structural gene, regulatory gene and operator gene.

 

23. A low level of expression of lac operon occurs at all the windows for treatment of various genetic disorders. Justify the statement.

 

24. Why the human genome project is called a mega project?

 

25. From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?

 

26. Why tRNA is called an adapter molecule?

 

27. What are the three structural differences between RNA and DNA?

 

28. Name the anticodon required to recognize the following codons: AAU, CGA, UAU, and GCA.

 

29. a) Identify the figure given below

b) Redraw the structure as a replicating fork and label the parts


c) Write the source of energy for this replication and name the enzyme involved in this process.

d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.

 

30. If the coding sequence in a transcription unit is written as follows:

5' TGCATGCATGCATGCATGCATGCATGC 3'

Write down the sequence of mRNA.

 

31. How is the two stage process of protein synthesis advantageous?

 

32.Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?

 

33. Explain the formation of a nucleosome.

 

34. It is established that RNA is the first genetic material. Justify giving reasons.



Tags : Important Questions and choose the correct answer - Zoology Important Questions and choose the correct answer - Zoology
Study Material, Lecturing Notes, Assignment, Reference, Wiki description explanation, brief detail


Copyright © 2018-2021 BrainKart.com; All Rights Reserved. (BS) Developed by Therithal info, Chennai.